Ch13 mRNA Translation | Test Bank – 7th Edition

View Product website:

https://selldocx.com/docx/ch13-mrna-translation-test-bank-7th-edition-1302

Student name:__________

1) Select the statements that are true regarding the experiments by Beadle and Tatum. (Check all that apply.)

A) They used the mold Neurospora as a model organism.
B) They isolated strains that could not grow on minimal media.
C) They established the link between a gene and an enzyme or protein.
D) They were able to create loss-of-function mutations in any enzyme they chose.

2) Select all stop codons.

A) UGA
B) UAA
C) UAG
D) AUG
E) UUA

3) Taking into account your knowledge of wobble rules, select all anticodons that can pair with the codon 5'-UAC-3'. (Check all that apply.)

A) 5'-AUG-3'
B) 5'-IUA-3'
C) 5'-AUA-3'
D) 5'-GUA-3'
E) 5'-GUI-3'

4) Based on our modern understanding, what revisions are necessary to the original one-gene / one-enzyme hypothesis? (Check all that apply.)

A) Alternative splicing allows one gene to encode multiple polypeptides.
B) Some genes encode RNAs, not enzymes.
C) Some genes encode lipids, not enzymes.
D) Some genes encode polypeptides that are not enzymes, such as structural proteins.
E) Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein.
F) Enzymes are not encoded by genes after all — they are constructed through separate biochemical processes.

5) What is true according to the adaptor hypothesis?

A) The anticodon and amino acid have no relationship.
B) A given tRNA can carry any of the twenty amino acids.
C) The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid.
D) An amino acid recognizes the codon in mRNA.

6) Select the codon that is not synonymous with CUU.

A) CUC
B) UUG
C) CUA
D) AUU
E) UUA

7) The primary structure of a protein is directly associated with __________.

A) regular repeating shapes, such as beta-sheets
B) the three-dimensional shape of the protein
C) the linear sequence of the amino acids
D) the interaction of two or more peptide chains

8) α-helices and β-sheets are examples of what level of protein structure?

A) Primary structure
B) Secondary structure
C) Tertiary structure
D) Quaternary structure

9) An anticodon is located on __________.

A) DNA
B) mRNA
C) rRNA
D) tRNA
E) snRNA

10) A tRNA that has an amino acid attached is called __________.

A) an rRNA
B) a degenerate tRNA
C) a coding tRNA
D) a charged tRNA

11) Kozak's rules for translation are similar to those for transcription in prokaryotes in that they both contain consensus sequences. In prokaryotes, the promoter consensus sequences are at -35 and -10. Where is the consensus sequence for translational initiation according to Kozak's rules?

A) -6 to +4
B) -12 to -2
C) +1 to +10
D) -9 to +1

12) Select the amino acid that has been activated by aminoacyl-tRNA synthetase.

A) Amino acid · ATP · aminoacyl-tRNA synthetase
B) Amino acid · aminoacyl-tRNA synthetase
C) Amino acid + AMP + PPi
D) Amino acid · AMP

13) What site on the ribosome is primarily responsible for holding the growing polypeptide?

A) A
B) E
C) P

14) What site does the initiator tRNA bind to on the ribosome?

A) A
B) E
C) P

15) What is responsible for binding the initiator tRNA in eukaryotes?

A) eIF2
B) EF-Tu
C) eIF3
D) EF-G

16) How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

A) 7
B) 8
C) 10
D) 13

17) Where are the ribosomal subunits assembled in eukaryotes?

A) Nucleus
B) Nucleoid
C) Nucleolus
D) Nuclear envelope

18) A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?

A) Glycine
B) Proline
C) Alanine
D) Arginine

19) Where does mRNA/tRNA codon-anticodon recognition take place?

A) 30S
B) 40S
C) 50S
D) The surface between the two ribosomal subunits

20) What typically terminates the process of translation?

A) Rho proteins
B) Aminoacyl tRNA synthase
C) rRNA
D) Stop codons
E) Introns

21) The decoding function of the ribosome is conducted by __________.

A) the 16S rRNA
B) tRNA
C) mRNA
D) snRNA
E) aminoacyl-tRNA synthetase

22) The peptidyl transferase is a component of __________.

A) DNA
B) tRNA
C) the ribosome
D) the protein being translated
E) mRNA

23) The C-terminus of a polypeptide always contains __________.

A) a stop codon
B) a carboxyl group
C) an amino group
D) carbon dioxide
E) None of these choices are correct.

24) RF1 and RF2 are active during _______.

A) initiation
B) elongation
C) termination
D) peptidyl transfer

25) You are studying the DNA of a person who you know has two defective copies of the gene that encodes phenylalanine hydroxylase. You are surprised to find that this person also carries two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will this person exhibit? (Assume pathway intermediates are not available from sources outside the phenylalanine breakdown pathway.)

A) This person will exhibit symptoms of alkaptonuria.
B) This person will exhibit symptoms of tyrosinosis.
C) This person will exhibit symptoms of phenylketonuria.
D) This person will exhibit symptoms of alkaptonuria and phenylketonuria.
E) This person will be phenotypically normal.

26) In the digestive system of animals, proteins called amylases and proteases break down large molecules (for example, starches or proteins) into smaller ones so that they can be absorbed by the intestine. What category of protein function do these proteins fall into?

A) Cell shape or organization
B) Transport
C) Movement
D) Cell signaling
E) Cell surface recognition
F) Enzymes

27) You perform a cell free translation experiment like Nirenberg and Matthaei, but you forget to write down what nucleotides you added to make the mRNA. You precipitate the translated polypeptides and measure the relative amount of radiolabeled amino acids incorporated into them. You get 25% proline, 25% threonine, 12.5% glutamine, 12.5% lysine, 12.5% asparagine, and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA?

A) Equal amounts of A, C, U, and G
B) 50% C and 50% A
C) 70% C and 30% A
D) 50% C and 50% U
E) 50% A and 50% G

28) What is the name of the enzyme that adds CCA to the 3' end of tRNAs?

A) tRNA nucleotidyltransferase
B) Aminoacyl-tRNA synthetase
C) RNA polymerase
D) Peptidyl transferase

29) Consider the following mRNA from a eukaryotic species. Which AUG codon is translation most likely to begin from?
5'-CCUAUGAGCCACCAUGGAUGCCAAAUGCA-3'

A) 1st
B) 2nd
C) 3rd
D) 4th

30) What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

A) 1
B) 2
C) 3
D) 4

31) You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?

A) 36%
B) 22%
C) 14%
D) 28%

32) Suppose you performed a triplet binding assay with the triplet 5'-UAA-3'. What radiolabeled amino acids do you expect to find bound to the filter?

A) Tyrosine
B) Asparagine
C) Methionine
D) None

33) You have cloned a gene for a mammalian mitochondrial protein that is rich in tryptophan. If you translate this protein in the cytoplasm rather than the mitochondria, what result do you expect?

A) The protein will be shorter than its mitochondrial counterpart.
B) The protein will be longer than its mitochondrial counterpart.
C) The protein will be the same as its mitochondrial counterpart.
D) The protein will contain completely different amino acids when compared to its mitochondrial counterpart.

34) The genetic code is nearly universal in nuclear DNA from bacteria to mammals.

⊚ true
⊚ false

35) All mature polypeptides contain a methionine at the N-terminus.

⊚ true
⊚ false

36) 61 different tRNAs are required for translation both in vivo and in vitro.

⊚ true
⊚ false

37) The structure of the ribosome is uniform throughout a eukaryotic cell.

⊚ true
⊚ false

38) The anticodon on the mRNA recognizes the codon on the tRNA.

⊚ true
⊚ false

39) During elongation, the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

⊚ true
⊚ false

40) Transcription and translation may occur simultaneously in prokaryotic cells.

⊚ true
⊚ false