Chapter 10 Complete Test Bank How Genes Work

Chapter 10: How Genes Work

MULTIPLE CHOICE

1. Prokaryotes lack membrane-enclosed organelles and thus do not have nuclei. Therefore, prokaryotic

2. A human gene put into a plant cell will

3. DNA technology can be used with all organisms because they all

4. Bacteria and humans use the same DNA components, and both kinds of cells also perform transcription and translation. Which of the following choices is a potentially significant outcome of this shared mechanism?

5. Protein-coding genes specify the production of ________ as their immediate product.

6. The function of genes is to control the production of

7. Which of the following does NOT take place in the nucleus?

8. The order of the bases in DNA determines the order of the

9. Some viruses produce an enzyme called reverse transcriptase which causes the reverse process of transcription. Based on your understanding of gene expression, this enzyme should produce ________ from a(n) ________ template.

10. In bacteria, the antibiotic erythromycin prevents ribosomes from functioning. The MOST likely reason that bacteria die from treatment with erythromycin is because the antibiotic

11. The key enzyme used during transcription is

12. As transcription begins, RNA polymerase binds to a segment of a gene called a(n)

13. Which of the following is true of transcription?

14. If a strand of DNA has the sequence CGTAA, the RNA made from this molecule will have the sequence

15. During transcription,

16. Following transcription, the

17. The information in a gene is encoded by the

18. A mutation occurs in the promoter of a protein-encoding gene. How might this mutation affect the production of the protein encoded by the gene?

19. The bases present in an RNA molecule are

20. In bacteria, the antibiotic chloramphenicol prevents amino acids from bonding. The MOST likely reason that bacteria die from treatment with chloramphenicol is because the antibiotic

21. Which molecules are involved in translation?

22. Which RNA molecule brings new amino acids to the growing protein chain in translation?

23. The importance of tRNA is that it

24. Which of the following is true of rRNA?

25. Which of the lettered arrows in the diagram below of translation indicates a codon?

26. During translation,

27. Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation. In this analogy, what would best match the job of the ribosome?

28. In bacteria, the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome. The MOST likely reason that bacteria die from treatment with tetracycline is because the antibiotic

29. An mRNA molecule that is 99 bases long will create a protein composed of

30. A smartphone app converts spoken English into Spanish. This is similar to the process by which ________ are converted into ________.

31. Each set of three bases in an mRNA molecule codes for one of 20 specific

32. The codon GAU codes for which amino acid?

33. Which of the following codons codes for proline?

34. Which of the following codons does NOT code for an amino acid?

35. Use the following chart to determine the chain of amino acids that would be produced by the entire mRNA sequence UGUACGAUAGGCUAG.

36. Which of the following codons codes for the same amino acid as the codon AGU?

37. What is the sequence of the codon to which the transfer RNA shown in the following figure would bind during translation?

38. Using the following chart, what chain of amino acids would be produced by the sequence of this very short, complete gene: UAUUAUGCCUGAGUGAAUUGCUA?

39. In the genetic code, a codon is ________ bases long for ________.

40. Which of the following is a codon?

41. Which of the following is NOT a feature of the genetic code?

42. In humans the tRNA with the anticodon AAU carries the amino acid leucine. In plants, this tRNA would

43. The expression of most genes is regulated by

44. Gene expression is

45. Gene regulation is the ability to

46. Liver cells are different from heart cells of the same organism because these cell types

47. A gene in a region of DNA that is wound more tightly around proteins in the nucleus will be

48. In humans, the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase. As a result,

49. In bacteria, a particular gene codes for a protein that helps the bacteria break down and use lactose as a food source. If no lactose is present, the

50. Since 1900, at least ________ people worldwide have died as a result of an H1N1 influenza infection.

1. The genetic code is ________, which means that all cells use the same code.

2. If a molecule of mRNA is a sentence, its bases are the letters and the codons are the ________.

3. The process of using an RNA template to make proteins is called ________.

4. A researcher finds a molecule that is made of nucleotides and has a single amino acid bound to one end. This molecule is most likely a ________ molecule.

5. A tRNA with the anticodon GGG would have the amino acid ________ bound to it.

6. A protein that binds to the ________ of DNA down-regulates protein production by inhibiting the binding of RNA polymerase.

1. Explain how different cells in a human body, such as liver cells and skin cells, house the same genetic material but have different functions.

2. A mutation in the promoter region of a specific gene prevents RNA polymerase from binding. How would this mutation affect the function of this gene?

3. DNA viruses cause disease when the host cell uses the viral DNA to produce more viruses. The host cell uses the viral DNA to make viral proteins as well as more viral DNA; these are then used to produce more viruses and cause disease. In a eukaryotic cell, the viral DNA is often inserted into the host genome. Explain why viral DNA that stays in the cytoplasm would not cause disease.

4. Transforming plants with a human gene produces a protein that is identical to the original human protein. Explain how this evidence demonstrates that the genetic code is universal, and list another experiment that could be used to further support this theory.

5. Bacteria do not have a nucleus, and therefore do not use RNA splicing after translation. The initial mRNA that is produced is translated directly. An experiment transforms a bacterial cell and a eukaryotic cell with an identical gene (of identical length). Explain how the proteins from each cell would differ.

6. A mutation that changes the anticodon of a tRNA is generally much more detrimental to a cell than a mutation that changes the codon of an mRNA. Explain why this might be the case.

7. Translate the following DNA sequence into a sequence of amino acids: TACTAAGGA.

8. Which of the following mutations would be more detrimental to an organism: 1) a mutation that changes the codon GGU to GGA, or 2) a mutation that changes the codon AAU to AAA? Defend your choice.

9. A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine. Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so, what are the sequences of mRNA and DNA? If not, why not?

10. Explain what is meant by “redundancy” in the genetic code.

11. A silent mutation is a mutation where a DNA nucleotide has changed, but the resulting protein is identical to the protein produced before the mutation. Explain why such a mutation is possible.

12. Organisms can regulate both transcription and translation to control gene expression. What is one advantage and one disadvantage of regulating transcription rather than translation?

13. One concern with biopharming is that genes used to produce desired proteins could “escape” a laboratory setting and spread to food crops. What does it mean for a gene to “escape?” How would food crops be affected?

1. RNA polymerase binds to the promoter more easily.

2. Fewer RNA polymerase enzymes are produced.

3. The mRNA molecules are broken down quickly in the cytoplasm.

4. More ribosomes are produced.

5. Fewer tRNA molecules are produced.

OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism. MSC: Applying

OBJ: 10.6 Describe how a cell can increase or decrease its expression of particular genes, and why this ability is important for an organism. MSC: Applying

6. mRNA

7. tRNA

8. rRNA

9. DNA

10. amino acids

11. RNA polymerase

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Applying

Match the descriptions to the molecules of transcription and translation.

12. contains groups of nucleotides called codons

13. double-stranded molecule that ultimately provides a template for protein synthesis

14. important part of ribosomes

15. molecule that carries amino acids to ribosomes

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Remembering

Match the steps of transcription and translation to the location they take place within a eukaryotic cell.

16. RNA splicing

17. pairing of codons and anticodons

18. recognition of a promoter gene

19. construction of an mRNA molecule

20. formation of a covalent bond between amino acids

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA | 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. | 10.3 List each step in the process of translation and describe the role of each type of RNA. MSC: Understanding

21. RNA splicing

22. RNA polymerase exposes the DNA template strand.

23. RNA polymerase binds to the promoter region.

24. RNA bases are paired with DNA bases.

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. MSC: Remembering

REF: 10.2 Two-Step Dance, Transcription: DNA to RNA

OBJ: 10.2 Caption a diagram of transcription, identifying each step in the process and the relevant molecules. MSC: Remembering

Put the following steps in the process of translation in chronological order.

25. A stop codon is reached.

26. Recognition occurs between a codon and an anticodon.

27. Amino acids are covalently bonded.

28. mRNA binds to a ribosome.

29. An amino acid chain is released.

REF: 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA.

MSC: Remembering

REF: 10.3 Two-Step Dance, Translation: RNA to Protein

OBJ: 10.3 List each step in the process of translation and describe the role of each type of RNA.

MSC: Remembering