Ch.15 Exam Questions Organellar Inheritance

Genetics, 6e (Hartwell)

Chapter 15 Organellar Inheritance

1) Extranuclear genes show a biparental inheritance pattern in yeast since

A) progeny from diploid vegetative growth can have the phenotype of the dominant phenotype.

B) progeny from diploid vegetative growth can have the phenotype of the α parent.

C) progeny from diploid vegetative growth can have the phenotype of only the a parent.

D) progeny from diploid vegetative growth can have the phenotype of either the a or the α parent.

2) In four o'clock plants, reciprocal crosses are performed with a green plant and a white plant. How will the offspring of the reciprocal crosses look?

A) The offspring of both crosses will be green.

B) The offspring will be white if the egg came from the white plant and green if the egg came from the green plant.

C) The offspring will be white if the sperm came from the white plant and green if the sperm came from the green plant.

D) The offspring of both crosses will be variegated.

3) In plant cells, DNA molecules are found inside which structures? (Select all that apply.)

A) the nucleus

B) the mitochondrial matrix

C) the chloroplast stroma

D) the cytoplasm

E) the space between the inner and outer mitochondrial membranes

4) Where are the molecules used to carry out photosynthesis encoded?

A) All are encoded in chloroplast DNA.

B) Some are encoded in chloroplast DNA and others in nuclear DNA.

C) All are encoded in nuclear DNA.

D) Some are encoded in nuclear DNA and others in mitochondrial DNA.

5) Which is an accurate description of organelle genomes? (Select all that apply.)

A) Translation in mitochondria and chloroplasts is often inhibited by bacterial antibiotics (e.g., chloramphenicol).

B) Like bacteria, mitochondria use N-formyl methionine and tRNAfmet in translation.

C) mtDNA and cpDNA are usually organized into nucleosomes by histones.

D) Like bacterial genes, mitochondrial and chloroplast genes do not have introns.

E) Like bacterial genomes, mitochondrial and chloroplast genomes in all species consist of one circular DNA molecule.

6) What does DNA sequencing suggest about the relationship between the nuclear and organellar genomes?

A) The same subset of mitochondrial genes has moved to the nuclear genome in all species.

B) Mitochondrial genes that are found in the nuclear genome do not have introns, suggesting that movement occurred via an RNA intermediate.

C) The mitochondrial and nuclear genomes are entirely independent of each other.

D) Some cells have two types of mitochondria that have different genome sequences.

E) Some proteins found in mitochondria are imported from the cytoplasm.

7) Variegated four o'clock leaves have white patches among the green areas due to

A) the presence of cells in which most of the mitochondria have a mutation that blocks electron transport.

B) the presence of cells in which most of the chloroplasts have a mutation that prevents synthesis of chlorophyll.

C) an incompletely penetrant mutation in a nuclear gene that prevents production of chlorophyll.

D) a recessive mutation in a nuclear gene that results in a defect in ribosomes.

8) Which is a true statement about mitochondrial genomes?

A) In most cases, the mitochondrial genome is transmitted, largely intact, from one parent to offspring.

B) Mitochondrial inheritance shows Mendel's principle of segregation.

C) Mitochondrial inheritance shows Mendel's principle of independent assortment.

D) All of the choices are correct.

9) For what purpose is a researcher likely to shoot plant cells with a gene gun?

A) to kill the cell

B) to introduce new DNA into the chloroplast genome

C) to introduce a mutation in the nuclear genome

D) to add a transgene to the mitochondrial genome

10) Why is a variegated plant considered heteroplasmic?

A) The plant has mutant and wild-type chloroplast DNAs distributed amongst the cells in different ratios.

B) The plant has only two types of cells, one with only mutant chloroplast DNAs and one with only wild-type chloroplast DNAs.

C) All of the plant's cells have mutant and wild-type chloroplast DNAs.

D) All of the plant's cells have mitochondria and chloroplasts.

11) Inhibitors of bacterial translation, such as chloramphenicol and erythromycin, usually

(Select all that apply.)

A) inhibit mitochondrial protein synthesis.

B) inhibit chloroplast protein synthesis.

C) inhibit eukaryotic cytoplasmic protein synthesis.

D) have no effect on mitochondrial protein synthesis.

E) have no effect on chloroplast protein synthesis.

12) Where are the proteins needed for photosynthesis produced? (Select all that apply.)

A) in the cytoplasm

B) in the chloroplasts

C) in the nucleus

D) in the mitochondria

13) What does UGA specify? (Select all that apply.)

A) a stop signal in the universal genetic code

B) the amino acid tryptophan in human mtDNA

C) a stop signal in human mtDNA

D) formyl-methionine in mtDNA

14) The codon UGA specifies

A) a stop signal in the universal genetic code and in human mtDNA.

B) the amino acid tryptophan in the universal genetic code and in human mtDNA.

C) formyl-methionine in mtDNA.

D) a stop signal in the universal genetic code and the amino acid tryptophan in human mtDNA.

15) Which has been associated with aging in humans?

A) an increase in the number of mitochondria

B) no change in the sequence of the mitochondrial genome

C) a decrease in mitochondrial function

D) an increase in mitochondrial function

16) Which of the following has been associated with Alzheimer's Disease?

A) loss of mitochondria

B) 5kb and 7.4kb deletions in mtDNA of heart cells

C) mutations in cytochrome oxidase c genes in brain cells

D) no change in mitochondrial function.

17) Which step in producing ATP is correctly paired with the location where it occurs?

A) Krebs cycle—mitochondrial matrix

B) formation of an electrochemical gradient—cytoplasm

C) glucose is broken down to produce pyruvate—space between inner and outer mitochondrial membranes

D) electron transport chain—outer mitochondrial membrane

E) breakdown of pyruvate to form NADH and FADH2—cytoplasm

18) What would be the most likely result if a scientist removes mitochondria from a human cell and attempts to grow them in culture?

A) The mitochondria originated from a prokaryotic cell, so the mitochondria will grow independently in culture.

B) Mitochondria require the products of nuclear genes to function, so the mitochondria will die soon after being removed from the cell.

C) The mitochondria will continue to produce ATP indefinitely only if a source of pyruvate is provided.

D) The mitochondria will grow more quickly in the presence of antibiotics that kill bacteria and reduce competition for resources with bacterial cells.

19) What did comparing the sequence of the mitochondrial genome in trypanosomes with the sequence of mature mitochondrial RNAs demonstrate?

A) The RNA sequences are similar to the genome sequence, but have insertions and deletions of uracil residues.

B) The RNA sequences align perfectly with the genomic DNA from which it is transcribed.

C) All of the proteins necessary for translation are encoded in the mitochondrial genome.

D) Translation is initiated in mitochondria only at AUG codons.

E) Some mature RNAs do not have start and stop codons.

20) Due to gene transfer between the organelles and the nucleus,

A) mitochondrial genomes in all species have the same genes.

B) a chloroplast from one plant species can be transferred to any other plant species.

C) mitochondria and chloroplasts have genes that allow them to live independently.

D) some proteins must be imported into organelles for their function.

E) organelle genomes experience lower rates of mutation than they would if gene transfer did not occur.

21) Which statement describes evidence in support of the endosymbiont theory?

A) The sequence of mitochondrial rRNA genes are most similar to the rRNA genes in purple bacteria.

B) Mitochondrial and chloroplast DNA is organized into nucleosomes.

C) Mitochondria and chloroplasts have genes that allow them to live independently.

D) Mitochondria, chloroplasts, and cytoplasmic translation are inhibited by antibiotics such as chloramphenicol.

22) What are characteristics of the pedigrees of families with mitochondrial diseases?

A) All children of affected mothers are usually affected regardless of their sex.

B) Only the male children of affected mothers are affected, female children are not affected.

C) Only female children of affected mothers are also affected, male children are not affected.

D) All children of affected males are usually affected.

23) Oocyte nuclear transfer can be used to

A) allow women with mitochondrial diseases to have normal offspring.

B) allow women with any genetic disease to have normal offspring.

C) allow parents to control all of the phenotypic characteristics of their children.

D) create embryos for stem cell therapy.

24) Which is true about mitochondria?

A) The mitochondrial genome is circular in all species.

B) Mitochondria are found in all eukaryotic cells, except those with chloroplasts.

C) Mitochondrial genomes vary in length from 6 kb to 2400 kb.

D) Translation in mitochondria utilizes the universal genetic code.

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′

25) If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?

A) Phe Asp His

B) Met Asn Gly Trp

C) Met Asn Gly

D) Translation will not begin.

26) If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded?

A) Phe Asp His

B) Met Asn Gly Trp

C) Met Asn Gly

D) Translation will not begin.

Researchers combined two yeast strains of opposite mating type; the a strain was resistant to chloramphenicol and the α strain was sensitive to chloramphenicol. The diploid progeny were allowed to undergo several cell divisions, and then the cells were replica plated on glycerol medium with and without chloramphenicol.

27) What results would you expect if mitochondria are inherited biparentally?

A) Some, but not all, yeast colonies found on the plate without chloramphenicol will also grow on the plate with chloramphenicol.

B) All of the yeast colonies on the plate without chloramphenicol will also grow on the plate with chloramphenicol.

C) Many yeast colonies will grow on the plate without chloramphenicol and no colonies will grow on the plate with chloramphenicol.

D) No colonies will grow on either plate.

28) What results would you expect if mitochondria are inherited uniparentally from the a strain?

A) Some, but not all, yeast colonies found on the plate without chloramphenicol will also grow on the plate with chloramphenicol.

B) All of the yeast colonies on the plate without chloramphenicol will also grow on the plate with chloramphenicol.

C) Many yeast colonies will grow on the plate without chloramphenicol and no colonies will grow on the plate with chloramphenicol.

D) No colonies will grow on either plate.

29) What results would you expect if mitochondria are inherited uniparentally from the α strain?

A) Some, but not all, yeast colonies found on the plate without chloramphenicol will also grow on the plate with chloramphenicol.

B) All of the yeast colonies on the plate without chloramphenicol will also grow on the plate with chloramphenicol.

C) Many yeast colonies will grow on the plate without chloramphenicol and no colonies will grow on the plate with chloramphenicol.

D) No colonies will grow on either plate.

30) LHON is a mitochondrial disease caused by weak hypomorphic mutations that affect the mitochondrial electron transport chain. Among the first symptoms of the disease is blindness. People with LHON are usually homoplasmic because retinas must be homoplasmic mutant for a person to have disease symptoms. Which is true about a female who is heteroplasmic for the mutation that causes LHON? (Select all that apply.)

A) She may have children who are blind due to LHON.

B) Some cells in her body are probably homoplasmic.

C) She is likely to develop the disease in other parts of her body.

D) All of her children will be homoplasmic for the wild-type mitochondria.

31) LHON is a rare mitochondrial disease caused by weak hypomorphic mutations that affect the mitochondrial electron transport chain. The first symptoms of the disease include blindness. People with LHON are usually homoplasmic because retinas must be homoplasmic mutant for a person to have disease symptoms. Which is true about a male who is heteroplasmic for the mutation that causes LHON? (Select all that apply.)

A) He is likely to develop the disease in other parts of his body.

B) He may have children who are blind due to LHON.

C) All of his children will most likely be homoplasmic for the wild-type mitochondria.

D) Some cells in his body are probably homoplasmic.